pvdf transfer kit biorad (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
96
Structured Review
Bio-Rad
pvdf transfer kit biorad
Pvdf Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 391 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pvdf+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm41850246-215-100-103
Average 96 stars, based on 391 article reviews
Pvdf Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 391 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pvdf+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm41850246-215-100-103
Average 96 stars, based on 391 article reviews
pvdf transfer kit biorad - by Bioz Stars,
2026-11
96/100 stars
Images
Related Articles
Western Blot:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Mass Spectrometry:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Chromatin Immunoprecipitation:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, BAC Assay:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Transgenic Assay:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Recombinant:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Plasmid Preparation:Article Title: Unveiling IRF4-steered regulation of context-dependent effector programs in CD4 + T cells under Th17- and Treg-skewing conditions. Article Snippet: Carl Roth Cat#: T871.1 Tween 20 PanReac AppliChem Cat#: A4974 Sodium pyruvate Carl Roth Cat#: 9182.1 Pierce 16 % Formaldehyde, methanol-free ThermoFisher Cat#: 28906 Triton X-100Carl RothCat#: 3051.2Lithium Chloride (LiCl) Carl Roth Cat#: 3739.1 RNAse A (10 mg/mL) Thermo Fisher Scientific Cat#: EN0531 Proteinase K (from Tritirachium album) Serva Cat#: 33755.01 HoechstImmunoChemistry TechnologiesCat#: ICT-639Mowiol In house N/A eBioscoence Monensin-Lösung (1,000x)InvitrogenCat#: 00-4505-51Ionomycin (from Streptomyces conglobatus) Sigma-Aldrich Cat#: I9657 Fixation/Permeabilization Concentrate Invitrogen Cat#: 00-5123-43 Fixation/Permeabilization Diluent Invitrogen Cat#: 00-5223-56 10x Permeabilization Buffer Invitrogen Cat#: 12766048 Roti-PreMix PBS Carl Roth Cat#: 0890.1 Trypsin Gold, Mass Spectrometry Grade Promega Cat#: V5280 IMDM, w/o: L-Glutamine, w: 3.024 g/L NaHCO3 PAN Biotech Cat#: P04-20250 Fetal calf serum (FCS) Thermo Fisher Scientific Cat#: A5670701 Nuclease-free water QIAGEN Cat#: 0890.1 ROTISOLV Acetonitrile R99,98 %, Ultra LC-MS Carl Roth Cat#: HN40.1 ROTISOLV water, Ultra LC-MS Carl Roth Cat#: HN43.1 Ethanol (pure) PanReac AppliChem Cat#: 141086.1211 Formic acid ROTIPURAN R99 %, LC-MS Grade Carl Roth Cat#: 1EHK.1 PageRulerTM Plus Prestained Protein Ladder, 10 to 250 kDa Thermo Fisher Scientific Cat#: 26619 GatewayTM LR ClonaseTM II Enzym-Mix Thermo Fisher Scientific Cat#: 11791020 LipofectamineTM 2000 Thermo Fisher Scientific Cat#: 11668019 h-Coelenterazine (Benzyl-) PJK Biotech Cat#: 102181 Critical commercial assays Naı̈ve CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#: 130-104-453 CD4+ T Cell Isolation Kit, human Miltenyi Biotec Cat#: 130-096-533 (Continued on next page) 20 Cell Reports 44, 115407, March 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Clean & Concentrator Zymo Cat#: D4014 NEBNext Ultra II DNA Library Prep Kit Illumina Cat#: E7645L Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#: Q32851 Trans-Blot TurboTM RTA Transfer Kit, Reverse Transcription:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Bicinchoninic Acid Protein Assay:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 In Situ:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 RNA Sequencing:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Gene Expression:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Real-time Polymerase Chain Reaction:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Software:Article Title: Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal (clone AC-74) anti-mouse b-Actin (Used at 1:5000) Sigma Aldrich RRID AB_476697, Cat# A2228 Polyclonal rabbit anti-mouse Dlk1 (Used at 1:250) Santa Cruz Biotechnology RRID AB_2292943, Cat# sc-25437 Monoclonal (D3B8) rabbit anti-mouse cleaved Notch1 (Val1744) (Used at 1:2000) Cell Signaling Technology RRID AB_2153348, Cat# 4147 Polyclonal rabbit anti-mouse pro-Sp-C (Used at 1:500) Millipore RRID AB_91588, Cat# AB3786 Polyclonal rabbit anti-Histone H3, phosphor (Ser10) (Used at 1:2000) Millipore RRID AB_310177, Cat# 06-570 Monoclonal hamster (8.1.1) anti-T1a (Used at 1:50) Developmental Studies Hybridoma Bank, University of Iowa RRID AB_531893 Polyclonal rabbit anti-RFP (Used at 1:200) Rockland Immunochemicals RRID AB_11182807, Cat# 600-401-379S Polyclonal chicken anti-GFP (Used at 1:500) Aves Laboratories RRID AB_10000240, Cat# GFP-1020 Rat APC anti-mouse EpCAM clone G8.8 (Used at 1:100) BioLegend RRID AB_1134102, Cat# 118214 Rat IgG2a, kappa clone RTK2758 (Used at 1:100) BioLegend RRID not listed, Cat # 400512 Monoclonal rat anti-mouse CD16/32 clone 93 (used at 0.042mg/ml) Biolegend RRID AB_312801, Cat#101302 Monoclonal rat anti-mouse CD45 clone 30-F11 (used at 0.016mg/ml) BioLegend RRID AB_312967, Cat# 103102 Rabbit anti CC10 polyclonal antibody, used 1:500 Fisher Cat# 07623MI Anti-GAPDH mouse monoclonal antibody, used 1:5000 Sigma Aldrich RRID AB_1078991, Cat# G8795 Rabbit anti Ki67 AbCam RRID AB_443209, Cat# ab15580 Bacterial and Virus Strains Pseudomonas aeruginosa P103 From Dr. Ruxana Sadikot, Emory University N/A Chemicals, Peptides, and Recombinant Proteins Tamoxifen Sigma Aldrich Cat#T5648 Dispase Corning Cat#354235 TriZol Thermo Fisher Cat#15596018 DNase I Sigma Aldrich Cat#D4263 Fetal Bovine Serum Sigma Aldrich Cat#12306C HEPES Life Technology Cat# 15630080 Penicillin/streptomycin GIBCO Cat# 15140122 Gentamicin/Amphotericin Lonza Cat# CC-4083 DMEM Corning Cellgro Cat#10-013-CV RIPA buffer Cell Signaling Technology Cat#9803 cOmplete Protease Inhibitor Cocktail Roche Cat#11-836-145-001 Red Blood Cell Lysis Buffer BioLegend Cat#420301 Bovine Serum Albumin MP Biomedicals Cat#180549 Normal Donkey Serum Jackson Immunoresearch Cat# 017-000-12 Paraformaldehyde Sigma Aldrich Cat#P6148 SYBR Green Roche Cat#04913914001 (Continued on next page) Cell Reports 26, 2942–2954.e1–e5, March 12, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperSignal West Pico Chemiluminescent Substrate Thermo Scientific Cat#34080 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat#34095 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000 Critical Commercial Assays RNeasy Kit QIAGEN Cat#74104 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 Micro BCA Protein Assay Kit Thermo Scientific Cat#23235 in situ Cell Death Kit TMR Sigma Aldrich Cat#12156792910 Deposited Data RNA sequencing NCBI Gene Expression Omnibus (GEO) database Accession Number: GSE 124259 Experimental Models: Organisms/Strains Mouse: SpC-CreER: Sfptctm(cre/ERT2)Blh Brigid Hogan, Duke University N/A Mouse: ROSA-ICN Dr. Ben Stanger, University of Pennsylvania N/A Mouse: Dlk1flox: Dlk1tm1.1Jvs/J The Jackson Laboratory IMSR Cat# JAX:019074 Mouse: Rosa-tomato:B6.CgGt(ROSA)26Sortm9(CAG- 81 tdTomato)Hze/J The Jackson Laboratory Stock No: 007914 Mouse: Notch-Venus: Tg(Cp-HIST1H2BB/ Venus)47Hadj/J The Jackson Laboratory IMSR Cat# JAX:020942 Mouse: ROSA-dnMAML: Dr. Warren Pear, University of Pennsylvania N/A Mouse: Rosa-YFP: B6.129X1-Gt(ROSA) 26Sortm1(EYFP)Cos/J The Jackson Laboratory IMSR Cat# JAX:006148 Mouse: C57BL/6 The Jackson Laboratory Stock No: 0664 Oligonucleotides Quantitative real-time PCR Primers Table S1 IDT or QIAGEN Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ ZEN v2.3 Zeiss Microscopy N/A AxioVision LE Zeiss Microscopy N/A QuantStudio v1.3 Applied Biosystems N/A Summit (v4.3) Beckman Coulter N/A Excel Microsoft N/A Other Western blot precast gels 4-20% SDSPAGE gels BioRad Cat#456-1094 Article Title: TRPML1 Promotes Protein Homeostasis in Melanoma Cells by Negatively Regulating MAPK and mTORC1 Signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER QIAprep Spin Miniprep Kit QIAGEN Cat# 27106 RIPA Buffer (10X) Cell Signaling Cat# 9806S Tris Base Fisher Scientific Cat# BP152, CAS:77-86-1 Hydrochloric Acid Fisher Scientific Cat# A144SI-212, CAS:7646-01-0 Sodium Chloride Research Products International Cat# S23020, CAS:7647-14-5 EDTA, pH 8.0 Thermo Fisher Cat# AM9260G, CAS:6381-92-6 10X Tris/Glycine/SDS Buffer BioRad Cat# 161-0732 Tween 20 Sigma Cat# P1379, CAS:9005-64-5 Clarity Western ECL Substrate BioRad Cat# 170-5061 SuperSignal West Femto Maximum Thermo Scientific Cat# 34095 Restore Western Blot Stripping Buffer Thermo Fisher Cat# 21059 Saponin Sigma Aldrich Cat# 47036, CAS:8047-15-2 Alexa Fluor 555 Azide Thermo Fisher Cat# A20012 Hoechst 33342 Thermo Fisher Cat# 62249, CAS:23491-52-3 Methanol, Optima LC/MS Grade Fisher Scientific Cat# A456, CAS:67-56-1 Ammonium Acetate, Optima LC/MS Grade Fisher Scientific Cat# A11450, CAS:631-61-8 Acetonitrile, Optima LC/MS Grade Fisher Scientific Cat# A955, CAS:75-05-8 Critical Commercial Assays CellEvent Caspase-3/7 Green Thermo Fisher Cat# C10423 Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C10276 Proteostat Aggresome Detection Kit Enzo Cat# ENZ-51023 Pierce BCA Protein Assay Kit Thermo Fisher Cat# 23227 MycoAlert Detection Kit Lonza Cat# LT07-218 Deposited Data Analyzed shRNA screen data This paper https://doi.org/10.17632/ndxtvbg4ty.1 Experimental Models: Cell Lines A375 melanoma cell line ATCC Cat# CRL-1619, RRID:CVCL_0132 HEK293T cell line ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains NOD.CB17-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice The Jackson Laboratory Cat# 005557 Oligonucleotides MCOLN1_E2_sgRNA_1_F: AAACTCGCCGTCGTC TCAAATACTC This paper N/A MCOLN1_E2_sgRNA_1_R: CACCGAGTATTTGAG ACGACGGCGA This paper N/A MCOLN1_E2_sgRNA_2_F: AAACTGCGACAAGTTT CGAGCCAAC This paper N/A MCOLN1_E2_sgRNA_2_R: CACCGTTGGCTCGAA ACTTGTCGCA This paper N/A MCOLN1_qPCR_F: CTGATGCTGCAAGTGGTCAAG This paper N/A MCOLN1_qPCR_R: GGTGTTCTCTTCCCGGAATGTC This paper N/A MCOLN1_pLOC_F: ggtaccgagctcggatccATGACAGC CCCGGCGGG This paper N/A MCOLN1_pLOC_R: cccggttcattagctagcTCAATTCA CCAGCAGCG This paper N/A Recombinant DNA pLOC-MCOLN1 Generated in-lab N/A pLOC-RFP Dharmacon Cat# OHS5832 pSpCas9(BB)-2A-GFP (PX458) Addgene Cat# 48318, RRID:Addgene_48138 (Continued on next page) e3 Cell Reports 28, 2293–2305.e1–e9, August 27, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pANT7_cGST_MCOLN1 DNASU Clone# HsCD00732386 psPAX2 Addgene Cat# 12260, RRID:Addgene_12260 pMD2.G Addgene Cat# 12259, RRID:Addgene_12259 Software and Algorithms BD FACSDiva 8.0 BD Biosciences http://www.bdbiosciences.com/in/ instruments/software/facsdiva/ FlowJo V10 BD Biosciences https://www.flowjo.com/ Zeiss ZEN 2.3 Zeiss https://www.zeiss.com/microscopy/us/ products/microscope-software/zen.html AutoQuant X3 Media Cybernetics http://www.mediacy.com/autoquantx3 Imaris V7.7.2 Bitplane http://www.bitplane.com/imaris77.aspx Analyst v1.6.3 SCIEX https://sciex.com/products/software/ analyst-software XCalibur 4.1.50 Thermo Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30487 Multiquant v2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Compound Discoverer 3.0 Thermo Scientific https://www.thermofisher.com/us/en/ home/industrial/mass-spectrometry/ liquid-chromatography-mass-spectrometrylc-ms/lc-ms-software/multi-omics-dataanalysis/compound-discoverer-software.html Trace Finder 4.1 Thermo Scientific https://www.thermofisher.com/order/catalog/ product/OPTON-30626 Prism 8 Graphpad https://www.graphpad.com/scientific- software/prism/ R 3.5.1 R-Project https://www.r-project.org/ Stats package RDocumentation https://www.rdocumentation.org/packages/ stats/versions/3.5.3 fBasics package R-Project https://cran.r-project.org/web/packages/ fBasics/index.html Car package R-Project https://cran.r-project.org/web/packages/ car/index.html Cutadapt Martin, 2011 https://cutadapt.readthedocs.io/en/stable/ Bowtie 2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Other shRNA-Non-targeting Dharmacon Cat# RHS4349 shRNA-Non-targeting Dharmacon Cat# RHS4346 Ion Channel GIPZ shRNA library Dharmacon Cat# RHS6045 Custom GIPZ shRNA library Dharmacon Ref# SO-2439595G shRNA-EIF3A Dharmacon Cat# RHS4430-200163810 shRNA-EIF3A Dharmacon Cat# RHS4430-200198846 shRNA-EIF3A Dharmacon Cat# RHS4430-99293356 4-20% polyacrylamide tris glycine SDS gel BioRad Cat# 4561095 Trans-Blot Turbo Mini Transfer kit, shRNA:Article Title: TRPML1 Promotes Protein Homeostasis in Melanoma Cells by Negatively Regulating MAPK and mTORC1 Signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER QIAprep Spin Miniprep Kit QIAGEN Cat# 27106 RIPA Buffer (10X) Cell Signaling Cat# 9806S Tris Base Fisher Scientific Cat# BP152, CAS:77-86-1 Hydrochloric Acid Fisher Scientific Cat# A144SI-212, CAS:7646-01-0 Sodium Chloride Research Products International Cat# S23020, CAS:7647-14-5 EDTA, pH 8.0 Thermo Fisher Cat# AM9260G, CAS:6381-92-6 10X Tris/Glycine/SDS Buffer BioRad Cat# 161-0732 Tween 20 Sigma Cat# P1379, CAS:9005-64-5 Clarity Western ECL Substrate BioRad Cat# 170-5061 SuperSignal West Femto Maximum Thermo Scientific Cat# 34095 Restore Western Blot Stripping Buffer Thermo Fisher Cat# 21059 Saponin Sigma Aldrich Cat# 47036, CAS:8047-15-2 Alexa Fluor 555 Azide Thermo Fisher Cat# A20012 Hoechst 33342 Thermo Fisher Cat# 62249, CAS:23491-52-3 Methanol, Optima LC/MS Grade Fisher Scientific Cat# A456, CAS:67-56-1 Ammonium Acetate, Optima LC/MS Grade Fisher Scientific Cat# A11450, CAS:631-61-8 Acetonitrile, Optima LC/MS Grade Fisher Scientific Cat# A955, CAS:75-05-8 Critical Commercial Assays CellEvent Caspase-3/7 Green Thermo Fisher Cat# C10423 Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C10276 Proteostat Aggresome Detection Kit Enzo Cat# ENZ-51023 Pierce BCA Protein Assay Kit Thermo Fisher Cat# 23227 MycoAlert Detection Kit Lonza Cat# LT07-218 Deposited Data Analyzed shRNA screen data This paper https://doi.org/10.17632/ndxtvbg4ty.1 Experimental Models: Cell Lines A375 melanoma cell line ATCC Cat# CRL-1619, RRID:CVCL_0132 HEK293T cell line ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains NOD.CB17-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice The Jackson Laboratory Cat# 005557 Oligonucleotides MCOLN1_E2_sgRNA_1_F: AAACTCGCCGTCGTC TCAAATACTC This paper N/A MCOLN1_E2_sgRNA_1_R: CACCGAGTATTTGAG ACGACGGCGA This paper N/A MCOLN1_E2_sgRNA_2_F: AAACTGCGACAAGTTT CGAGCCAAC This paper N/A MCOLN1_E2_sgRNA_2_R: CACCGTTGGCTCGAA ACTTGTCGCA This paper N/A MCOLN1_qPCR_F: CTGATGCTGCAAGTGGTCAAG This paper N/A MCOLN1_qPCR_R: GGTGTTCTCTTCCCGGAATGTC This paper N/A MCOLN1_pLOC_F: ggtaccgagctcggatccATGACAGC CCCGGCGGG This paper N/A MCOLN1_pLOC_R: cccggttcattagctagcTCAATTCA CCAGCAGCG This paper N/A Recombinant DNA pLOC-MCOLN1 Generated in-lab N/A pLOC-RFP Dharmacon Cat# OHS5832 pSpCas9(BB)-2A-GFP (PX458) Addgene Cat# 48318, RRID:Addgene_48138 (Continued on next page) e3 Cell Reports 28, 2293–2305.e1–e9, August 27, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pANT7_cGST_MCOLN1 DNASU Clone# HsCD00732386 psPAX2 Addgene Cat# 12260, RRID:Addgene_12260 pMD2.G Addgene Cat# 12259, RRID:Addgene_12259 Software and Algorithms BD FACSDiva 8.0 BD Biosciences http://www.bdbiosciences.com/in/ instruments/software/facsdiva/ FlowJo V10 BD Biosciences https://www.flowjo.com/ Zeiss ZEN 2.3 Zeiss https://www.zeiss.com/microscopy/us/ products/microscope-software/zen.html AutoQuant X3 Media Cybernetics http://www.mediacy.com/autoquantx3 Imaris V7.7.2 Bitplane http://www.bitplane.com/imaris77.aspx Analyst v1.6.3 SCIEX https://sciex.com/products/software/ analyst-software XCalibur 4.1.50 Thermo Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30487 Multiquant v2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Compound Discoverer 3.0 Thermo Scientific https://www.thermofisher.com/us/en/ home/industrial/mass-spectrometry/ liquid-chromatography-mass-spectrometrylc-ms/lc-ms-software/multi-omics-dataanalysis/compound-discoverer-software.html Trace Finder 4.1 Thermo Scientific https://www.thermofisher.com/order/catalog/ product/OPTON-30626 Prism 8 Graphpad https://www.graphpad.com/scientific- software/prism/ R 3.5.1 R-Project https://www.r-project.org/ Stats package RDocumentation https://www.rdocumentation.org/packages/ stats/versions/3.5.3 fBasics package R-Project https://cran.r-project.org/web/packages/ fBasics/index.html Car package R-Project https://cran.r-project.org/web/packages/ car/index.html Cutadapt Martin, 2011 https://cutadapt.readthedocs.io/en/stable/ Bowtie 2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Other shRNA-Non-targeting Dharmacon Cat# RHS4349 shRNA-Non-targeting Dharmacon Cat# RHS4346 Ion Channel GIPZ shRNA library Dharmacon Cat# RHS6045 Custom GIPZ shRNA library Dharmacon Ref# SO-2439595G shRNA-EIF3A Dharmacon Cat# RHS4430-200163810 shRNA-EIF3A Dharmacon Cat# RHS4430-200198846 shRNA-EIF3A Dharmacon Cat# RHS4430-99293356 4-20% polyacrylamide tris glycine SDS gel BioRad Cat# 4561095 Trans-Blot Turbo Mini Transfer kit, SDS-Gel:Article Title: TRPML1 Promotes Protein Homeostasis in Melanoma Cells by Negatively Regulating MAPK and mTORC1 Signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER QIAprep Spin Miniprep Kit QIAGEN Cat# 27106 RIPA Buffer (10X) Cell Signaling Cat# 9806S Tris Base Fisher Scientific Cat# BP152, CAS:77-86-1 Hydrochloric Acid Fisher Scientific Cat# A144SI-212, CAS:7646-01-0 Sodium Chloride Research Products International Cat# S23020, CAS:7647-14-5 EDTA, pH 8.0 Thermo Fisher Cat# AM9260G, CAS:6381-92-6 10X Tris/Glycine/SDS Buffer BioRad Cat# 161-0732 Tween 20 Sigma Cat# P1379, CAS:9005-64-5 Clarity Western ECL Substrate BioRad Cat# 170-5061 SuperSignal West Femto Maximum Thermo Scientific Cat# 34095 Restore Western Blot Stripping Buffer Thermo Fisher Cat# 21059 Saponin Sigma Aldrich Cat# 47036, CAS:8047-15-2 Alexa Fluor 555 Azide Thermo Fisher Cat# A20012 Hoechst 33342 Thermo Fisher Cat# 62249, CAS:23491-52-3 Methanol, Optima LC/MS Grade Fisher Scientific Cat# A456, CAS:67-56-1 Ammonium Acetate, Optima LC/MS Grade Fisher Scientific Cat# A11450, CAS:631-61-8 Acetonitrile, Optima LC/MS Grade Fisher Scientific Cat# A955, CAS:75-05-8 Critical Commercial Assays CellEvent Caspase-3/7 Green Thermo Fisher Cat# C10423 Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C10276 Proteostat Aggresome Detection Kit Enzo Cat# ENZ-51023 Pierce BCA Protein Assay Kit Thermo Fisher Cat# 23227 MycoAlert Detection Kit Lonza Cat# LT07-218 Deposited Data Analyzed shRNA screen data This paper https://doi.org/10.17632/ndxtvbg4ty.1 Experimental Models: Cell Lines A375 melanoma cell line ATCC Cat# CRL-1619, RRID:CVCL_0132 HEK293T cell line ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains NOD.CB17-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice The Jackson Laboratory Cat# 005557 Oligonucleotides MCOLN1_E2_sgRNA_1_F: AAACTCGCCGTCGTC TCAAATACTC This paper N/A MCOLN1_E2_sgRNA_1_R: CACCGAGTATTTGAG ACGACGGCGA This paper N/A MCOLN1_E2_sgRNA_2_F: AAACTGCGACAAGTTT CGAGCCAAC This paper N/A MCOLN1_E2_sgRNA_2_R: CACCGTTGGCTCGAA ACTTGTCGCA This paper N/A MCOLN1_qPCR_F: CTGATGCTGCAAGTGGTCAAG This paper N/A MCOLN1_qPCR_R: GGTGTTCTCTTCCCGGAATGTC This paper N/A MCOLN1_pLOC_F: ggtaccgagctcggatccATGACAGC CCCGGCGGG This paper N/A MCOLN1_pLOC_R: cccggttcattagctagcTCAATTCA CCAGCAGCG This paper N/A Recombinant DNA pLOC-MCOLN1 Generated in-lab N/A pLOC-RFP Dharmacon Cat# OHS5832 pSpCas9(BB)-2A-GFP (PX458) Addgene Cat# 48318, RRID:Addgene_48138 (Continued on next page) e3 Cell Reports 28, 2293–2305.e1–e9, August 27, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pANT7_cGST_MCOLN1 DNASU Clone# HsCD00732386 psPAX2 Addgene Cat# 12260, RRID:Addgene_12260 pMD2.G Addgene Cat# 12259, RRID:Addgene_12259 Software and Algorithms BD FACSDiva 8.0 BD Biosciences http://www.bdbiosciences.com/in/ instruments/software/facsdiva/ FlowJo V10 BD Biosciences https://www.flowjo.com/ Zeiss ZEN 2.3 Zeiss https://www.zeiss.com/microscopy/us/ products/microscope-software/zen.html AutoQuant X3 Media Cybernetics http://www.mediacy.com/autoquantx3 Imaris V7.7.2 Bitplane http://www.bitplane.com/imaris77.aspx Analyst v1.6.3 SCIEX https://sciex.com/products/software/ analyst-software XCalibur 4.1.50 Thermo Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30487 Multiquant v2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Compound Discoverer 3.0 Thermo Scientific https://www.thermofisher.com/us/en/ home/industrial/mass-spectrometry/ liquid-chromatography-mass-spectrometrylc-ms/lc-ms-software/multi-omics-dataanalysis/compound-discoverer-software.html Trace Finder 4.1 Thermo Scientific https://www.thermofisher.com/order/catalog/ product/OPTON-30626 Prism 8 Graphpad https://www.graphpad.com/scientific- software/prism/ R 3.5.1 R-Project https://www.r-project.org/ Stats package RDocumentation https://www.rdocumentation.org/packages/ stats/versions/3.5.3 fBasics package R-Project https://cran.r-project.org/web/packages/ fBasics/index.html Car package R-Project https://cran.r-project.org/web/packages/ car/index.html Cutadapt Martin, 2011 https://cutadapt.readthedocs.io/en/stable/ Bowtie 2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Other shRNA-Non-targeting Dharmacon Cat# RHS4349 shRNA-Non-targeting Dharmacon Cat# RHS4346 Ion Channel GIPZ shRNA library Dharmacon Cat# RHS6045 Custom GIPZ shRNA library Dharmacon Ref# SO-2439595G shRNA-EIF3A Dharmacon Cat# RHS4430-200163810 shRNA-EIF3A Dharmacon Cat# RHS4430-200198846 shRNA-EIF3A Dharmacon Cat# RHS4430-99293356 4-20% polyacrylamide tris glycine SDS gel BioRad Cat# 4561095 Trans-Blot Turbo Mini Transfer kit, |